Skip to main content

pX330_SpCas9_USP7 Exon 3 gRNA
(Plasmid #131257)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131257 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-Cbh-hSpCas9
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 42230)
  • Backbone size w/o insert (bp) 8506
  • Total vector size (bp) 8509
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    humanised S. pyogenes Cas9 nuclease
  • Alt name
    hSpCas9
  • gRNA/shRNA sequence
    AGACCACACCAAAAAAGCGT

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 was from Feng Zhang (Addgene plasmid # 42230)
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330_SpCas9_USP7 Exon 3 gRNA was a gift from Roger Woodgate (Addgene plasmid # 131257 ; http://n2t.net/addgene:131257 ; RRID:Addgene_131257)
  • For your References section:

    DNA Polymerase iota Interacts with Both the TRAF-like and UBL1-2 Domains of USP7. Ashton NW, Valles GJ, Jaiswal N, Bezsonova I, Woodgate R. J Mol Biol. 2021 Jan 22;433(2):166733. doi: 10.1016/j.jmb.2020.166733. Epub 2020 Dec 3. 10.1016/j.jmb.2020.166733 PubMed 33279577