Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLentiCRISPRv2-TRAF6-targeting sgRNA 1
(Plasmid #131345)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 131345 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLentiCRISPRv2
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA targeting mouse TRAF6
  • gRNA/shRNA sequence
    GATGGAACTGAGACATCTCG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Traf6 (a.k.a. 2310003F17Rik, AI851288, C630032O20Rik)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv2-TRAF6-targeting sgRNA 1 was a gift from Jonathan Kagan (Addgene plasmid # 131345 ; http://n2t.net/addgene:131345 ; RRID:Addgene_131345)
  • For your References section:

    Innate Immune Signaling Organelles Display Natural and Programmable Signaling Flexibility. Tan Y, Kagan JC. Cell. 2019 Apr 4;177(2):384-398.e11. doi: 10.1016/j.cell.2019.01.039. Epub 2019 Mar 7. 10.1016/j.cell.2019.01.039 PubMed 30853218