Skip to main content

pLentiCRISPRv2-TRAF6-targeting sgRNA 2
(Plasmid #131346)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131346 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLentiCRISPRv2
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA targeting mouse TRAF6
  • gRNA/shRNA sequence
    GGAGATCCAGGGCTACGATG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Traf6 (a.k.a. 2310003F17Rik, C630032O20Rik)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv2-TRAF6-targeting sgRNA 2 was a gift from Jonathan Kagan (Addgene plasmid # 131346 ; http://n2t.net/addgene:131346 ; RRID:Addgene_131346)
  • For your References section:

    Innate Immune Signaling Organelles Display Natural and Programmable Signaling Flexibility. Tan Y, Kagan JC. Cell. 2019 Apr 4;177(2):384-398.e11. doi: 10.1016/j.cell.2019.01.039. Epub 2019 Mar 7. 10.1016/j.cell.2019.01.039 PubMed 30853218