pLentiCRISPRv2-TRAF6-targeting sgRNA 2
(Plasmid
#131346)
-
PurposegRNA targeting mouse TRAF6
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131346 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLentiCRISPRv2
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA targeting mouse TRAF6
-
gRNA/shRNA sequenceGGAGATCCAGGGCTACGATG
-
SpeciesM. musculus (mouse)
-
Entrez GeneTraf6 (a.k.a. 2310003F17Rik, C630032O20Rik)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPRv2-TRAF6-targeting sgRNA 2 was a gift from Jonathan Kagan (Addgene plasmid # 131346 ; http://n2t.net/addgene:131346 ; RRID:Addgene_131346) -
For your References section:
Innate Immune Signaling Organelles Display Natural and Programmable Signaling Flexibility. Tan Y, Kagan JC. Cell. 2019 Apr 4;177(2):384-398.e11. doi: 10.1016/j.cell.2019.01.039. Epub 2019 Mar 7. 10.1016/j.cell.2019.01.039 PubMed 30853218