-
PurposeExpresses engineered RT-1306 with His-tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131521 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET30
- Backbone size w/o insert (bp) 5211
- Total vector size (bp) 6930
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRT-1306
-
SpeciesSynthetic
-
Insert Size (bp)1719
- Promoter T7
-
Tag
/ Fusion Protein
- His-tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET30-RT1306 was a gift from Bryan Dickinson (Addgene plasmid # 131521 ; http://n2t.net/addgene:131521 ; RRID:Addgene_131521) -
For your References section:
Evolution of a reverse transcriptase to map N(1)-methyladenosine in human messenger RNA. Zhou H, Rauch S, Dai Q, Cui X, Zhang Z, Nachtergaele S, Sepich C, He C, Dickinson BC. Nat Methods. 2019 Dec;16(12):1281-1288. doi: 10.1038/s41592-019-0550-4. Epub 2019 Sep 23. 10.1038/s41592-019-0550-4 PubMed 31548705