pCAG-T3-CjCAS9-pA
(Plasmid
#131543)
-
PurposeExpresses Campylobacter jejuni-derived Cas9 nuclease in mammalian cells. Used to modify genome of mouse embroys
-
Depositing Lab
-
Depositing OrganizationThe University of Tokyo
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131543 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCAG-T3-hCAS9-pA
- Total vector size (bp) 8538
-
Modifications to backboneThe human codon optimized CjCas9 ORF was inserted into the NotI to ClaI site of pCAG-T3-hCAS9-pA plasmid (Addgene #48625).
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCjCas9
-
Alt nameCjeCas9
-
SpeciesSynthetic; Campylobacter jejuni
-
Insert Size (bp)3051
-
MutationHuman codon-optimized
- Promoter CAG, T3
-
Tags
/ Fusion Proteins
- FLAG-SV40NLS (N terminal on insert)
- SV40NLS (C terminal on insert)
- polyA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer TGGGCAACGTGCTGGTTATTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-T3-CjCAS9-pA was a gift from Wataru Fujii (Addgene plasmid # 131543 ; http://n2t.net/addgene:131543 ; RRID:Addgene_131543) -
For your References section:
Efficient Generation of Genome-Modified Mice Using Campylobacter jejuni-Derived CRISPR/Cas. Fujii W, Ikeda A, Sugiura K, Naito K. Int J Mol Sci. 2017 Oct 31;18(11). pii: ijms18112286. doi: 10.3390/ijms18112286. 10.3390/ijms18112286 PubMed 29088065