Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAG-T3-CjCAS9-pA
(Plasmid #131543)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 131543 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAG-T3-hCAS9-pA
  • Total vector size (bp) 8538
  • Modifications to backbone
    The human codon optimized CjCas9 ORF was inserted into the NotI to ClaI site of pCAG-T3-hCAS9-pA plasmid (Addgene #48625).
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CjCas9
  • Alt name
    CjeCas9
  • Species
    Synthetic; Campylobacter jejuni
  • Insert Size (bp)
    3051
  • Mutation
    Human codon-optimized
  • Promoter CAG, T3
  • Tags / Fusion Proteins
    • FLAG-SV40NLS (N terminal on insert)
    • SV40NLS (C terminal on insert)
    • polyA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer TGGGCAACGTGCTGGTTATTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-T3-CjCAS9-pA was a gift from Wataru Fujii (Addgene plasmid # 131543 ; http://n2t.net/addgene:131543 ; RRID:Addgene_131543)
  • For your References section:

    Efficient Generation of Genome-Modified Mice Using Campylobacter jejuni-Derived CRISPR/Cas. Fujii W, Ikeda A, Sugiura K, Naito K. Int J Mol Sci. 2017 Oct 31;18(11). pii: ijms18112286. doi: 10.3390/ijms18112286. 10.3390/ijms18112286 PubMed 29088065