Skip to main content

pCAG-T3-CjCAS9-pA
(Plasmid #131543)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131543 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 131543-D50 50 μg of DNA in Tris buffer $495
DNA 131543-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCAG-T3-hCAS9-pA
  • Total vector size (bp) 8538
  • Modifications to backbone
    The human codon optimized CjCas9 ORF was inserted into the NotI to ClaI site of pCAG-T3-hCAS9-pA plasmid (Addgene #48625).
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CjCas9
  • Alt name
    CjeCas9
  • Species
    Synthetic; Campylobacter jejuni
  • Insert Size (bp)
    3051
  • Mutation
    Human codon-optimized
  • Promoter CAG, T3
  • Tags / Fusion Proteins
    • FLAG-SV40NLS (N terminal on insert)
    • SV40NLS (C terminal on insert)
    • polyA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer TGGGCAACGTGCTGGTTATTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-T3-CjCAS9-pA was a gift from Wataru Fujii (Addgene plasmid # 131543 ; http://n2t.net/addgene:131543 ; RRID:Addgene_131543)
  • For your References section:

    Efficient Generation of Genome-Modified Mice Using Campylobacter jejuni-Derived CRISPR/Cas. Fujii W, Ikeda A, Sugiura K, Naito K. Int J Mol Sci. 2017 Oct 31;18(11). pii: ijms18112286. doi: 10.3390/ijms18112286. 10.3390/ijms18112286 PubMed 29088065