pAAV-CreLite
(Plasmid
#131785)
-
PurposeAAV donor/transfer vector expressing CreLite system components, PhyBΔCreC and PIF6CreN, driven by CBh promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131785 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerFrom William Lagor Lab
- Backbone size w/o insert (bp) 3271
- Total vector size (bp) 6862
-
Modifications to backboneRemoved WPRE sequence and added a synthetic polyA sequence
-
Vector typeMammalian Expression, AAV, Cre/Lox, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePhyBCreC-P2A-PIF6CreN
-
Alt nameCreALite
-
SpeciesA. thaliana (mustard weed), Synthetic; Bacteriophage P1
-
Insert Size (bp)3591
-
GenBank ID816394 825382
- Promoter CBh
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer CBh_F: ttctgcttcactctccccatc
- 3′ sequencing primer SynPA Rev: cacacaaaaaaccaacacacagatctaatg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThis synthetic gene was originally designed and cloned by Shuo-Ting Yen and then the sequence was modified by William Lagor for cloning purpose. Finally, the insert was synthesized by GeneWiz. The final cloning step is done by Shuo-Ting Yen.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Read the preprint at bioRxiv: doi.org/10.1101/823971.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CreLite was a gift from George Eisenhoffer (Addgene plasmid # 131785 ; http://n2t.net/addgene:131785 ; RRID:Addgene_131785) -
For your References section:
CreLite: An optogenetically controlled Cre/loxP system using red light. Yen ST, Trimmer KA, Aboul-Fettouh N, Mullen RD, Culver JC, Dickinson ME, Behringer RR, Eisenhoffer GT. Dev Dyn. 2020 Nov;249(11):1394-1403. doi: 10.1002/dvdy.232. Epub 2020 Aug 31. 10.1002/dvdy.232 PubMed 32745301