pLenti-CreLite
(Plasmid #131786)

• Purpose: Lentiviral vector expressing CreLite, driven by CBh peromoter
• Depositing Lab: George Eisenhoffer
• Publication: Yen et al Dev Dyn. 2020 Nov;249(11):1394-1403. doi: 10.1002/dvdy.232. Epub 2020 Aug 31.

Backbone

• Vector backbone: pLV
• Backbone manufacturer: VectorBuilder
• Backbone size w/o insert (bp): 9000
• Total vector size (bp): 12455
• Vector type: Mammalian Expression, Lentiviral, Cre/Lox, Synthetic Biology
• Selectable markers: Puromycin ; mTagBFP2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PhyBCreC-P2A-PIF6CreN
• Alt name: CreALite
• Species: A. thaliana (mustard weed), Synthetic; Bacteriophage P1
• Insert Size (bp): 3507
• GenBank ID: 816394 825382
• Promoter: CBh

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CBh_F: ttctgcttcactctccccatc
• 3′ sequencing primer: attB2: ccactttgtacaagaaagctgggt

Resource Information

• Supplemental Documents:
  • pLenti-CreLite.gbk
• A portion of this plasmid was derived from a plasmid made by: This plasmid is designed by Shuo-Ting Yen and subcloned by VectorBuilder.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Read the preprint at bioRxiv: doi.org/10.1101/823971.