pLenti-CreLite
(Plasmid
#131786)
-
PurposeLentiviral vector expressing CreLite, driven by CBh peromoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131786 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLV
-
Backbone manufacturerVectorBuilder
- Backbone size w/o insert (bp) 9000
- Total vector size (bp) 12455
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox, Synthetic Biology
-
Selectable markersPuromycin ; mTagBFP2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePhyBCreC-P2A-PIF6CreN
-
Alt nameCreALite
-
SpeciesA. thaliana (mustard weed), Synthetic; Bacteriophage P1
-
Insert Size (bp)3507
-
GenBank ID816394 825382
- Promoter CBh
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CBh_F: ttctgcttcactctccccatc
- 3′ sequencing primer attB2: ccactttgtacaagaaagctgggt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThis plasmid is designed by Shuo-Ting Yen and subcloned by VectorBuilder.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Read the preprint at bioRxiv: doi.org/10.1101/823971.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-CreLite was a gift from George Eisenhoffer (Addgene plasmid # 131786 ; http://n2t.net/addgene:131786 ; RRID:Addgene_131786) -
For your References section:
CreLite: An optogenetically controlled Cre/loxP system using red light. Yen ST, Trimmer KA, Aboul-Fettouh N, Mullen RD, Culver JC, Dickinson ME, Behringer RR, Eisenhoffer GT. Dev Dyn. 2020 Nov;249(11):1394-1403. doi: 10.1002/dvdy.232. Epub 2020 Aug 31. 10.1002/dvdy.232 PubMed 32745301