Skip to main content

AAVS1 CAG rtTA3 TauWT 2N4R-EGFP
(Plasmid #132389)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132389 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    AAVS1-T2A-Puro-Cas9-TREtight
  • Backbone manufacturer
    Addgene
  • Total vector size (bp) 8048
  • Vector type
    Mammalian Expression, Cre/Lox, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Bacteria may truncate DNA, please select multiple clones and perform restriction digest after purification to confirm.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human TauWT 2N4R-EGFP
  • Species
    H. sapiens (human), Synthetic
  • Entrez Gene
    MAPT (a.k.a. DDPAC, FTD1, FTDP-17, MAPTL, MSTD, MTBT1, MTBT2, PPND, PPP1R103, TAU, Tau-PHF6, tau-40)
  • Promoter TREtight
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbvCI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer TTCAGGTTGGACCGGTCCTCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains a 55 basepair deletion in the poly-GC track of the CAG promoter. It is unknown if this deletion affects plasmid function, but depositing lab was able to properly express proteins from the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1 CAG rtTA3 TauWT 2N4R-EGFP was a gift from Gerold Schmitt-Ulms (Addgene plasmid # 132389 ; http://n2t.net/addgene:132389 ; RRID:Addgene_132389)
  • For your References section:

    Rapid Generation of Human Neuronal Cell Models Enabling Inducible Expression of Proteins-of-interest for Functional Studies. Wang X, Friesen E, Muller I, Lemieux M, Dukart R, Maia IB, Kalia S, Schmitt-Ulms G. Bio Protoc. 2020 May 5;10(9):e3615. doi: 10.21769/BioProtoc.3615. eCollection 2020 May 5. 10.21769/BioProtoc.3615 PubMed 33659578