pspCas9-ABE-3'UTR-sgRNA-Tetra-com-vector
(Plasmid
#132560)
-
PurposeVector plasmid expressing ABEmax and sgRNA scaffold with com replacing the Tetraloop.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132560 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameABEmax
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CMV-R: tgccaagtgggcagtttac
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesgRNA, with Tetraloop replaced by com aptamer
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer LKO-F: GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pspCas9-ABE-3'UTR-sgRNA-Tetra-com-vector was a gift from Baisong Lu (Addgene plasmid # 132560 ; http://n2t.net/addgene:132560 ; RRID:Addgene_132560) -
For your References section:
Adenine Base Editor Ribonucleoproteins Delivered by Lentivirus-Like Particles Show High On-Target Base Editing and Undetectable RNA Off-Target Activities. Lyu P, Lu Z, Cho SI, Yadav M, Yoo KW, Atala A, Kim JS, Lu B. CRISPR J. 2021 Feb;4(1):69-81. doi: 10.1089/crispr.2020.0095. 10.1089/crispr.2020.0095 PubMed 33616436