Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV8-hSyn-flex-miR30-eGFP-shNts
(Plasmid #132717)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 132717 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-hSyn-flex-miR30
  • Backbone manufacturer
    Addgene Plasmid #67845
  • Backbone size w/o insert (bp) 4811
  • Total vector size (bp) 5950
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    GFP-shNts
  • Alt name
    GFP-shNts fragment from pPRIME-CMV-GFP- shNts(1) vector
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1138
  • GenBank ID
    NM_001102381
  • Entrez Gene
    Nts
  • Promoter Synapsin 1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer TGCCTGAGAGCGCAGTCG
  • 3′ sequencing primer AGCAGCGTATCCACATAGCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV8-hSyn-flex-miR30-eGFP-shNts was a gift from Robert Messing (Addgene plasmid # 132717 ; http://n2t.net/addgene:132717 ; RRID:Addgene_132717)
  • For your References section:

    Dissecting the Roles of GABA and Neuropeptides from Rat Central Amygdala CRF Neurons in Anxiety and Fear Learning. Pomrenze MB, Giovanetti SM, Maiya R, Gordon AG, Kreeger LJ, Messing RO. Cell Rep. 2019 Oct 1;29(1):13-21.e4. doi: 10.1016/j.celrep.2019.08.083. 10.1016/j.celrep.2019.08.083 PubMed 31577943