pJYScr
(Plasmid
#132719)
-
Purpose(Empty Backbone) Plasmid for an easy-to-construct crRNA delivery vector using hybridized oligonucleotides. Constitutive transcription of crRNA, Spectinomycin resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132719 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJYS2_crtYf
-
Backbone manufacturerYang S
- Backbone size (bp) 4380
-
Modifications to backboneModification of restriction sites, insertion of an 931 bp BamHI-BstBI-dummy fragment
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- 5′ sequencing primer pJYS2_fw2 GTGTCAGTGAAAGGCGCATCC
- 3′ sequencing primer pJYS2_rv2 TCGCCACCTCTGACTTGAGCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJYScr was a gift from Jan Marienhagen (Addgene plasmid # 132719 ; http://n2t.net/addgene:132719 ; RRID:Addgene_132719) -
For your References section:
CRISPR/Cas12a Mediated Genome Editing To Introduce Amino Acid Substitutions into the Mechanosensitive Channel MscCG of Corynebacterium glutamicum. Krumbach K, Sonntag CK, Eggeling L, Marienhagen J. ACS Synth Biol. 2019 Dec 11. doi: 10.1021/acssynbio.9b00361. 10.1021/acssynbio.9b00361 PubMed 31790583