-
PurposeFRET biosensor for ATP measurements in budding yeast
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132781 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDRF1-GW
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameyAT1.03 ymTq2-tdTomato
-
SpeciesB. Subtilis
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI, SpeI, XbaI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer AACAATCGTTAATAATTAATTAATTGG
- 3′ sequencing primer GAGTCACTTTAAAATTTGTATACAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDRF1-GW yAT1.03 was a gift from Bas Teusink (Addgene plasmid # 132781 ; http://n2t.net/addgene:132781 ; RRID:Addgene_132781) -
For your References section:
An Improved ATP FRET Sensor For Yeast Shows Heterogeneity During Nutrient Transitions. Botman D, van Heerden JH, Teusink B. ACS Sens. 2020 Mar 27;5(3):814-822. doi: 10.1021/acssensors.9b02475. Epub 2020 Mar 3. 10.1021/acssensors.9b02475 PubMed 32077276