Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #92179)


Item Catalog # Description Quantity Price (USD)
Plasmid 92179 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Voth et al. (2001) Nucleic Acids Res (PMID: 11410682)
  • Backbone size w/o insert (bp) 6062
  • Total vector size (bp) 6038
  • Modifications to backbone
    The entire backbone was used except for the poly region. Because we used Gibson DNA assembly to construct the plasmid we did not need restriction sites and the poly region.
  • Vector type
    Yeast Expression ; Integration and expression into yeast.
  • Selectable markers
    G418 (Geneticin)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    ATeam1.03 codon optimized for yeast (Saccharomyces cerevisiae)
  • Alt name
    ATP FRET sensor
  • Species
  • Insert Size (bp)
  • GenBank ID
  • Promoter TEF1p
  • Tag / Fusion Protein
    • Yeast codon optimized mseCFP (donor) and cp173-mVenus (acceptor) are parts of the ATeam1.03 FRET sensor.

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGAGTATTGTGTCATGTTCG
  • 3′ sequencing primer GACAGTCACATCATGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The original version of the ATeam1.03 FRET sensor (tested in mammalian cells but not codon optimized for yeast) was published in 2009 by Imamura et al (PMID: 19720993)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTEF:ATP was a gift from Matthias Heinemann (Addgene plasmid # 92179 ; ; RRID:Addgene_92179)
  • For your References section:

    Autonomous Metabolic Oscillations Robustly Gate the Early and Late Cell Cycle. Papagiannakis A, Niebel B, Wit EC, Heinemann M. Mol Cell. 2017 Jan 19;65(2):285-295. doi: 10.1016/j.molcel.2016.11.018. Epub 2016 Dec 15. 10.1016/j.molcel.2016.11.018 PubMed 27989441