pTEF:ATP
(Plasmid #92179)

• Purpose: HO-TEF1p-ATeam1.03-KanMX4-HO. Codon optimized for yeast version of the ATeam1.03 ATP FRET sensor (originally from Imamura et al. PNAS, 2009 ), expressed via the TEF1 promoter. HO locus integration.
• Depositing Lab: Matthias Heinemann
• Publication: Papagiannakis et al Mol Cell. 2017 Jan 19;65(2):285-295. doi: 10.1016/j.molcel.2016.11.018. Epub 2016 Dec 15.

Backbone

• Vector backbone: HO-poly-KanMX4-HO
• Backbone manufacturer: Voth et al. (2001) Nucleic Acids Res (PMID: 11410682)
• Backbone size w/o insert (bp): 6062
• Total vector size (bp): 6038
• Modifications to backbone: The entire backbone was used except for the poly region. Because we used Gibson DNA assembly to construct the plasmid we did not need restriction sites and the poly region.
• Vector type: Yeast Expression ; Integration and expression into yeast.
• Selectable markers: G418 (Geneticin)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ATeam1.03 codon optimized for yeast (Saccharomyces cerevisiae)
• Alt name: ATP FRET sensor
• Species: Synthetic
• Insert Size (bp): 1836
• GenBank ID:
• Promoter: TEF1p
• Tag / Fusion Protein:
  • Yeast codon optimized mseCFP (donor) and cp173-mVenus (acceptor) are parts of the ATeam1.03 FRET sensor.

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGAGTATTGTGTCATGTTCG
• 3′ sequencing primer: GACAGTCACATCATGCC

Resource Information

• Supplemental Documents:
  • TEF_ATP_HOKANMX.txt
  • ATeam1.03 codon optimization for yeast
  • Ab1 files for the deposited partial sequences
• A portion of this plasmid was derived from a plasmid made by: The codon optimized version of the ATeam1.03 FRET sensor was synthesized for us.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The original version of the ATeam1.03 FRET sensor (tested in mammalian cells but not codon optimized for yeast) was published in 2009 by Imamura et al (PMID: 19720993)