Skip to main content

pHD-SPARC2-I-LexA::p65
(Plasmid #133563)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133563 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHD-3XP3-DsRed-DattP-CRISPR-donor-attP40
  • Backbone manufacturer
    Isaacman-Beck et al., 2019
  • Backbone size w/o insert (bp) 8307
  • Total vector size (bp) 10007
  • Vector type
    Insect Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LexA::p65
  • Promoter 20X UAS

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACGACTACCTGGCCGTTCCT
  • 3′ sequencing primer AGCGACCACCCGATCCAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/788679v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHD-SPARC2-I-LexA::p65 was a gift from Tom Clandinin (Addgene plasmid # 133563 ; http://n2t.net/addgene:133563 ; RRID:Addgene_133563)
  • For your References section:

    SPARC enables genetic manipulation of precise proportions of cells. Isaacman-Beck J, Paik KC, Wienecke CFR, Yang HH, Fisher YE, Wang IE, Ishida IG, Maimon G, Wilson RI, Clandinin TR. Nat Neurosci. 2020 Sep;23(9):1168-1175. doi: 10.1038/s41593-020-0668-9. Epub 2020 Jul 20. 10.1038/s41593-020-0668-9 PubMed 32690967