-
PurposeExpresses the gePSI-α-chain and ZsGreen1 under control of the inducible bi-directional TRE3G promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 133730 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTRE3G-BI-ZsGreen1
-
Backbone manufacturerTakaraBio Clontech
- Backbone size w/o insert (bp) 2839
- Total vector size (bp) 3961
-
Modifications to backboneThe backbone for this plasmid is ‘pTRE3G-BI-ZsGreen1’ from the pTRE3G-BI-ZsGreen1 Vector Set (Cat. No. 631334) from TakaraBio Clontech. We inserted the gePSI-aChain downstream of the pTRE3G promoter using Gibson Cloning.
-
Vector typeMammalian Expression
-
Selectable markersNo selectable marker
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namea-Chain_gePSI
-
SpeciesZea mays
-
Insert Size (bp)426
-
MutationOnly one part of the gePSI-system (aa1-141 + stop codon)
- Promoter pTRE3G-Bi
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGAACGTATAAGCTTTAGGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameZsGreen1
-
SpeciesZoanthus sp.
-
Insert Size (bp)696
- Promoter pTRE3G-Bi
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer - (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRE3G-Bi-α-chain was a gift from Erin Schuman (Addgene plasmid # 133730 ; http://n2t.net/addgene:133730 ; RRID:Addgene_133730) -
For your References section:
A genetically encodable cell-type-specific protein synthesis inhibitor. Heumuller M, Glock C, Rangaraju V, Biever A, Schuman EM. Nat Methods. 2019 Jul 15. pii: 10.1038/s41592-019-0468-x. doi: 10.1038/s41592-019-0468-x. 10.1038/s41592-019-0468-x PubMed 31308551