Skip to main content

pcDNA3.1.Gα12-LgB115
(Plasmid #134363)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134363 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 7048
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gα12-LgB115
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1695
  • GenBank ID
  • Entrez Gene
    GNA12 (a.k.a. HG1M1, NNX3, RMP, gep)
  • Promoter T7
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TTCCCAATCCTCCCCCTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1.Gα12-LgB115 was a gift from Julien Hanson (Addgene plasmid # 134363 ; http://n2t.net/addgene:134363 ; RRID:Addgene_134363)
  • For your References section:

    A dynamic and screening-compatible nanoluciferase-based complementation assay enables profiling of individual GPCR-G protein interactions. Laschet C, Dupuis N, Hanson J. J Biol Chem. 2019 Mar 15;294(11):4079-4090. doi: 10.1074/jbc.RA118.006231. Epub 2018 Dec 28. 10.1074/jbc.RA118.006231 PubMed 30593506