-
PurposeNanoluc complementation assay. Expression of dopamine receptor D2 fused at C terminus with Natural peptide (NP) of NanoLuc. Addition of the signal sequence and Flag epitope at N terminus of D2.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134366 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 6870
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameD2-NP
-
Alt nameDRD2-Natural peptide of NanoLuciferase
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1494
-
GenBank IDNM_016574.3
-
Entrez GeneDRD2 (a.k.a. D2DR, D2R)
- Promoter T7
-
Tags
/ Fusion Proteins
- signal sequence (N terminal on insert)
- Flag (N terminal on insert)
- natural peptide of nanoluciferase (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TTCCCAATCCTCCCCCTTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1.D2-NP was a gift from Julien Hanson (Addgene plasmid # 134366 ; http://n2t.net/addgene:134366 ; RRID:Addgene_134366) -
For your References section:
A dynamic and screening-compatible nanoluciferase-based complementation assay enables profiling of individual GPCR-G protein interactions. Laschet C, Dupuis N, Hanson J. J Biol Chem. 2019 Mar 15;294(11):4079-4090. doi: 10.1074/jbc.RA118.006231. Epub 2018 Dec 28. 10.1074/jbc.RA118.006231 PubMed 30593506