-
PurposeExpresses EGFP-tagged lysosomal marker
-
Depositing Lab
-
Depositing OrganizationSunnybrook Research Institute
Located in Canada -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134868 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLVX-EF1a-IRES-Puromycin
- Backbone size w/o insert (bp) 8825
- Total vector size (bp) 10862
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLysosomal-associated membrane protein 1
-
Alt nameLAMP-1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1251
-
Entrez GeneLAMP1 (a.k.a. CD107a, LAMPA, LGP120)
- Promoter EF1a
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATGCGATGGAGTTTCCCCAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byLAMP-1-GFP subcloned from Addgene #34831
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-EF1a-LAMP-1-mGFP-IRES-Puromycin was a gift from David Andrews (Addgene plasmid # 134868 ; http://n2t.net/addgene:134868 ; RRID:Addgene_134868) -
For your References section:
A reference library for assigning protein subcellular localizations by image-based machine learning. Schormann W, Hariharan S, Andrews DW. J Cell Biol. 2020 Mar 2;219(3). pii: 133635. doi: 10.1083/jcb.201904090. 10.1083/jcb.201904090 PubMed 31968357