pU6-(BsaI)_CBh-Cas9-T2A-mCherry
(Plasmid
#135012)
-
PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 linked to mCherry via a T2A peptide
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135012 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepU6-(BbsI)_CBh-Cas9-T2A-mCherry (Addgene 64324), modification of pX330 (Addgene 42230)
-
Backbone manufacturerKuehn lab
- Total vector size (bp) 9285
-
Modifications to backboneSites for cloning sgRNAs changed to BsaI. Sticky ends for cloning sgRNAs are the same as the original parent vectors.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehumanized S. pyogenes Cas9
-
Alt nameSpCas9
-
Alt namehSpCas9
-
Specieshumanized S. pyogenes
-
Insert Size (bp)4272
- Promoter CBh
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert) (N terminal on insert)
- 3x Flag (N terminal on insert)
- NLS (N terminal on insert)
- NLS (C terminal on insert)
- T2A-mCherry (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer agggatggttggttggtggg
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-(BsaI)_CBh-Cas9-T2A-mCherry was a gift from Yosef Shaul (Addgene plasmid # 135012 ; http://n2t.net/addgene:135012 ; RRID:Addgene_135012) -
For your References section:
Recruitment of DNA Repair MRN Complex by Intrinsically Disordered Protein Domain Fused to Cas9 Improves Efficiency of CRISPR-Mediated Genome Editing. Reuven N, Adler J, Broennimann K, Myers N, Shaul Y. Biomolecules. 2019 Oct 8;9(10). pii: biom9100584. doi: 10.3390/biom9100584. 10.3390/biom9100584 PubMed 31597252