-
PurposeOverexpression of multiple human genes (BCL2 and BCL6)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135305 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneMSCV_IRES_huDC2
- Backbone size w/o insert (bp) 6574
- Total vector size (bp) 9496
-
Modifications to backboneBCL6-t2A-BCL2 were cloned into MSCV_IRES_huDC2 using Gibson Assembly
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameBCL6
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2118
-
GenBank IDXM_005247694
-
Entrez GeneBCL6 (a.k.a. BCL5, BCL6A, LAZ3, ZBTB27, ZNF51)
- Promoter LTR
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameBCL2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)720
-
GenBank IDNM_000633
-
Entrez GeneBCL2 (a.k.a. Bcl-2, PPP1R50)
- Promoter LTR
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer AAGCCCTACAAATGCGAAACCTGC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-BCL6-t2A-BCL2 was a gift from Daniel Hodson (Addgene plasmid # 135305 ; http://n2t.net/addgene:135305 ; RRID:Addgene_135305) -
For your References section:
Genetic modification of primary human B cells to model high-grade lymphoma. Caeser R, Di Re M, Krupka JA, Gao J, Lara-Chica M, Dias JML, Cooke SL, Fenner R, Usheva Z, Runge HFP, Beer PA, Eldaly H, Pak HK, Park CS, Vassiliou GS, Huntly BJP, Mupo A, Bashford-Rogers RJM, Hodson DJ. Nat Commun. 2019 Oct 4;10(1):4543. doi: 10.1038/s41467-019-12494-x. 10.1038/s41467-019-12494-x PubMed 31586074