Skip to main content

3XFLAG-VP64-SadCas9-NLS-VP64
(Plasmid #135338)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135338 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pX601
  • Backbone manufacturer
    Addgene (61591)
  • Backbone size w/o insert (bp) 4010
  • Total vector size (bp) 7667
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SadCas9
  • Alt name
    dSauCas9
  • Alt name
    dSaCas9
  • Species
    Staphylococcus aureus
  • Insert Size (bp)
    3405
  • Mutation
    D10A and N580A
  • Promoter CMV
  • Tags / Fusion Proteins
    • 3xFLAG-VP64-SV40 NLS (N terminal on insert)
    • NLS-VP64 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGCACCAAAATCAACGGGACTTTC
  • 3′ sequencing primer CTTTCAAGTTACGGTAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    N/A
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3XFLAG-VP64-SadCas9-NLS-VP64 was a gift from Ronald Cohn (Addgene plasmid # 135338 ; http://n2t.net/addgene:135338 ; RRID:Addgene_135338)
  • For your References section:

    A mutation-independent approach for muscular dystrophy via upregulation of a modifier gene. Kemaladewi DU, Bassi PS, Erwood S, Al-Basha D, Gawlik KI, Lindsay K, Hyatt E, Kember R, Place KM, Marks RM, Durbeej M, Prescott SA, Ivakine EA, Cohn RD. Nature. 2019 Aug;572(7767):125-130. doi: 10.1038/s41586-019-1430-x. Epub 2019 Jul 24. 10.1038/s41586-019-1430-x PubMed 31341277