Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

3XFLAG-VP64-SadCas9-NLS-VP64
(Plasmid #135338)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 135338 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pX601
  • Backbone manufacturer
    Addgene (61591)
  • Backbone size w/o insert (bp) 4010
  • Total vector size (bp) 7667
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    2xVP64-SadCas9
  • Species
    Staphylococcus aureus
  • Insert Size (bp)
    3405
  • Mutation
    D10A and N580A
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGCACCAAAATCAACGGGACTTTC
  • 3′ sequencing primer CTTTCAAGTTACGGTAAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    N/A
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3XFLAG-VP64-SadCas9-NLS-VP64 was a gift from Ronald Cohn (Addgene plasmid # 135338 ; http://n2t.net/addgene:135338 ; RRID:Addgene_135338)
  • For your References section:

    A mutation-independent approach for muscular dystrophy via upregulation of a modifier gene. Kemaladewi DU, Bassi PS, Erwood S, Al-Basha D, Gawlik KI, Lindsay K, Hyatt E, Kember R, Place KM, Marks RM, Durbeej M, Prescott SA, Ivakine EA, Cohn RD. Nature. 2019 Aug;572(7767):125-130. doi: 10.1038/s41586-019-1430-x. Epub 2019 Jul 24. 10.1038/s41586-019-1430-x PubMed 31341277