Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #135402)


Item Catalog # Description Quantity Price (USD)
Plasmid 135402 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Alt name
    Transcription factor EB
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
  • Tag / Fusion Protein
    • sfGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer TAACAACTCCGCCCCATTGA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMRX-IP TFEB-sfGFP was a gift from Eisuke Itakura (Addgene plasmid # 135402 ; ; RRID:Addgene_135402)
  • For your References section:

    Identification of a factor controlling lysosomal homeostasis using a novel lysosomal trafficking probe. Ishii S, Matsuura A, Itakura E. Sci Rep. 2019 Aug 12;9(1):11635. doi: 10.1038/s41598-019-48131-2. 10.1038/s41598-019-48131-2 PubMed 31406169