Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-hSyn-Flex-Axon-EGFP
(Plasmid #135429)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 135429 Standard format: Plasmid sent in bacteria as agar stab 1 $75
AAV1 135429-AAV1 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid.
$380

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-hSyn1-DIO-SSFO-EYFP-P2A-nlsdTomato-WPRE-BGHpA
  • Backbone manufacturer
    Jonathan Ting
  • Total vector size (bp) 5463
  • Modifications to backbone
    A fragment containing axon-EGFP was swapped in to replace SSFO-EYFP-P2A-nlsdTomato in the backbone. Total AAV packaging size (including ITRs and DNA in between) is 2867 BP.
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    axon-EGFP
  • Alt name
    Axon-Enhanced Green Fluorescent Protein
  • Species
    A. victoria
  • Insert Size (bp)
    1069
  • Promoter hSyn1
  • Tag / Fusion Protein
    • GAP43 palmitoylation domain (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AGTCGAGAAACCGGCTAGAG
  • 3′ sequencing primer CCAGAGGTTGATTATCGATA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    EGFP was synthesized de novo based on sequences published by Stanley Falkow's laboratory (Cormack et al, 1996, Gene). The Axon(Gap43) targeting sequence fused to GFP was previously published by Lin Tian's lab in Broussard et al, 2018 PMID: PMC6697169

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid can be used to express Axon-targeted EGFP in neurons that express Cre. It is useful for studies aiming map projections from a given class of Cre-expressing neuron or to image structural axon dynamics.

Information for AAV1 (Catalog # 135429-AAV1) ( Back to top )

Purpose

Ready-to-use AAV1 particles produced from pAAV-hSyn-Flex-Axon-EGFP (#135429). In addition to the viral particles, you will also receive purified pAAV-hSyn-Flex-Axon-EGFP plasmid DNA.

Syn-driven, Cre-dependent expression of axon-targeted EGFP control. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EGFP (Cre-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-Flex-Axon-EGFP was a gift from Rylan Larsen (Addgene plasmid # 135429 ; http://n2t.net/addgene:135429 ; RRID:Addgene_135429)

    For viral preps, please replace (Addgene plasmid # 135429) in the above sentence with: (Addgene viral prep # 135429-AAV1)