EF1α-eGFP-Z1
(Plasmid
#135612)
-
PurposeEnhanced green fluorescent protein expression for mammalian cells under EF1a-HTLV promoter in minimal backbone plasmid.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135612 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneZ1
-
Backbone manufacturerGreen lab
- Total vector size (bp) 2869
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
Alt nameEnhanced Green Fluorescent Protein
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter EF1a-HTLV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer gttacagatccaagctgtgacc
- 3′ sequencing primer GATGAGTTTGGACAAACCAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EF1α-eGFP-Z1 was a gift from Jordan Green (Addgene plasmid # 135612 ; http://n2t.net/addgene:135612 ; RRID:Addgene_135612)