Skip to main content

pcDNA3-His:CRY2:nls:VPR
(Plasmid #135989)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135989 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    ThermoFisher
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 8539
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    CRY2 domain fused to the VPR activation domain
  • Species
    H. sapiens (human), M. musculus (mouse), A. thaliana (mustard weed)
  • Promoter CMV
  • Tag / Fusion Protein
    • His (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    CRY2 domain fused to the VPR activation domain
  • Species
    H. sapiens (human), M. musculus (mouse), A. thaliana (mustard weed)
  • Insert Size (bp)
    3126
  • Tag / Fusion Protein
    • His (N terminal on insert)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-His:CRY2:nls:VPR was a gift from Roman Jerala (Addgene plasmid # 135989 ; http://n2t.net/addgene:135989 ; RRID:Addgene_135989)
  • For your References section:

    A tunable orthogonal coiled-coil interaction toolbox for engineering mammalian cells. Lebar T, Lainscek D, Merljak E, Aupic J, Jerala R. Nat Chem Biol. 2020 Jan 6. pii: 10.1038/s41589-019-0443-y. doi: 10.1038/s41589-019-0443-y. 10.1038/s41589-019-0443-y PubMed 31907374