pcDNA3-His:CRY2:nls:VPR
(Plasmid
#135989)
-
PurposeExpresses the CRY2 blue light-inducible domain fused to the VPR transcriptional activation domain in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135989 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerThermoFisher
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 8539
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCRY2 domain fused to the VPR activation domain
-
SpeciesH. sapiens (human), M. musculus (mouse), A. thaliana (mustard weed)
- Promoter CMV
-
Tag
/ Fusion Protein
- His (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCRY2 domain fused to the VPR activation domain
-
SpeciesH. sapiens (human), M. musculus (mouse), A. thaliana (mustard weed)
-
Insert Size (bp)3126
-
Tag
/ Fusion Protein
- His (N terminal on insert)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-His:CRY2:nls:VPR was a gift from Roman Jerala (Addgene plasmid # 135989 ; http://n2t.net/addgene:135989 ; RRID:Addgene_135989) -
For your References section:
A tunable orthogonal coiled-coil interaction toolbox for engineering mammalian cells. Lebar T, Lainscek D, Merljak E, Aupic J, Jerala R. Nat Chem Biol. 2020 Jan 6. pii: 10.1038/s41589-019-0443-y. doi: 10.1038/s41589-019-0443-y. 10.1038/s41589-019-0443-y PubMed 31907374