pSLIK_hygro_3xflag_NRF2(RR)
(Plasmid
#136535)
-
PurposeLentiviral expression vector for an inducible 3xflag-tagged NRF2(a1584c_a1586t_a1589g)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 136535 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSLIK-hygro
-
Backbone manufacturerAddgene #25737
- Backbone size w/o insert (bp) 13286
-
Vector typeMammalian Expression, Lentiviral ; destinatioin vector for gateway cloning
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNRF2(1584A>C,1586A>T,1589A>G)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1815
-
MutationThis plasmid is developed by mutating 3 base pairs within the sequence targeted by shNRF2 version 1 (c.1584A>C,c.1586A>T,c.1589A>G) of NRF2 sequence in the pEN_TTmiRc2_3xflag_NRF2 plasmid using QuickChange II XL site-directed mutagenesis kit to create an RNAi-resistant version of NRF2. These base pair changes do not change the amino acid sequence, but switch the codons to rare codons in the human genome. Primer used: ctggaaaatatagtagaactagagcaagatttcgttcgtttgaaagatgaaaaagaaaaattgctcaaa
-
GenBank IDNM_006164
-
Entrez GeneNFE2L2 (a.k.a. HEBP1, IMDDHH, NRF2, Nrf-2)
-
Tag
/ Fusion Protein
- 3x FLAG (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CMV-F
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLIK_hygro_3xflag_NRF2(RR) was a gift from Kevin Janes (Addgene plasmid # 136535 ; http://n2t.net/addgene:136535 ; RRID:Addgene_136535) -
For your References section:
Sporadic activation of an oxidative stress-dependent NRF2-p53 signaling network in breast epithelial spheroids and premalignancies. Pereira EJ, Burns JS, Lee CY, Marohl T, Calderon D, Wang L, Atkins KA, Wang CC, Janes KA. Sci Signal. 2020 Apr 14;13(627). pii: 13/627/eaba4200. doi: 10.1126/scisignal.aba4200. 10.1126/scisignal.aba4200 PubMed 32291314