pLV-dfROX
(Plasmid
#137170)
-
PurposeLentiviral transfer vector for expression of roGFP2 and HyPer Red
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 137170 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSDM101
- Backbone size w/o insert (bp) 11143
- Total vector size (bp) 11974
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)HB101
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameroGFP2-2A-HyPer Red
-
SpeciesSynthetic
-
Insert Size (bp)2208
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site Sali/BsaI (not destroyed)
- 5′ sequencing primer pLV-Seq-F1: GTGTCGTGAGGAATTTCGAC
- 3′ sequencing primer EGFP-C-forward: CATGGTCCTGCTGGAGTTCGTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-dfROX was a gift from Shaun McCullough (Addgene plasmid # 137170 ; http://n2t.net/addgene:137170 ; RRID:Addgene_137170) -
For your References section:
Exposure Effects Beyond the Epithelial Barrier: Trans-Epithelial Induction of Oxidative Stress by Diesel Exhaust Particulates in Lung Fibroblasts in an Organotypic Human Airway Model. Faber SC, McNabb NA, Ariel P, Aungst ER, McCullough SD. Toxicol Sci. 2020 Jun 11. pii: 5856111. doi: 10.1093/toxsci/kfaa085. 10.1093/toxsci/kfaa085 PubMed 32525552