Skip to main content
Addgene

pCW57-mCherry-2A-BRD4 Iso C
(Plasmid #137721)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 137721 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCW57-GFP-2A-MCS
  • Backbone size w/o insert (bp) 8400
  • Total vector size (bp) 8639
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Slow growing plasmid, may need to incubate for >1 day
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    BRD4 short isoform
  • Alt name
    BRD4
  • Alt name
    isoform C
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_014299.2 NP_055114.1
  • Entrez Gene
    BRD4 (a.k.a. CAP, CDLS6, FSHRG4, HUNK1, HUNKI, MCAP)
  • Promoter Tight TRE promoter
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCTGGGACGAGATTGAGAAATCTG
  • 3′ sequencing primer CAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57-mCherry-2A-BRD4 Iso C was a gift from Scott Floyd (Addgene plasmid # 137721 ; http://n2t.net/addgene:137721 ; RRID:Addgene_137721)
  • For your References section:

    BRD4 Prevents R-Loop Formation and Transcription-Replication Conflicts by Ensuring Efficient Transcription Elongation. Edwards DS, Maganti R, Tanksley JP, Luo J, Park JJH, Balkanska-Sinclair E, Ling J, Floyd SR. Cell Rep. 2020 Sep 22;32(12):108166. doi: 10.1016/j.celrep.2020.108166. 10.1016/j.celrep.2020.108166 PubMed 32966794