-
Purpose(Empty Backbone) Lentivirus reporter assay plasmid that contains a I-SceI site and a EGFP reporter gene.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 137725 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLS-SceI
- Backbone size (bp) 7811
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTTCTTGTGTATATCCGGTC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLS-SceI was a gift from Nadav Ahituv (Addgene plasmid # 137725 ; http://n2t.net/addgene:137725 ; RRID:Addgene_137725) -
For your References section:
lentiMPRA and MPRAflow for high-throughput functional characterization of gene regulatory elements. Gordon MG, Inoue F, Martin B, Schubach M, Agarwal V, Whalen S, Feng S, Zhao J, Ashuach T, Ziffra R, Kreimer A, Georgakopoulous-Soares I, Yosef N, Ye CJ, Pollard KS, Shendure J, Kircher M, Ahituv N. Nat Protoc. 2020 Aug;15(8):2387-2412. doi: 10.1038/s41596-020-0333-5. Epub 2020 Jul 8. 10.1038/s41596-020-0333-5 PubMed 32641802