Skip to main content

pM2s2TsR
(Plasmid #137923)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 137923 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMUT2
  • Backbone manufacturer
    Native to E. coli Nissle
  • Backbone size w/o insert (bp) 3173
  • Total vector size (bp) 6442
  • Modifications to backbone
    pMUT2 was modified with an insulated cassette with a selection marker
  • Vector type
    Bacterial Expression, Synthetic Biology ; For use with E. coli Nissle in the mouse gut

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mRFP1
  • Species
    Synthetic
  • Insert Size (bp)
    678
  • Promoter J23101

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTTCCTTATCATCTGGCGAATCGG
  • 3′ sequencing primer GAGACGAGACGAGACAGCCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pM2s2TsR was a gift from Neel Joshi (Addgene plasmid # 137923 ; http://n2t.net/addgene:137923 ; RRID:Addgene_137923)
  • For your References section:

    Plasmid Vectors for in Vivo Selection-Free Use with the Probiotic E. coli Nissle 1917. Kan A, Gelfat I, Emani S, Praveschotinunt P, Joshi NS. ACS Synth Biol. 2020 Dec 10. doi: 10.1021/acssynbio.0c00466. 10.1021/acssynbio.0c00466 PubMed 33301298