Skip to main content

H513 px330.sgActin.UTR.2
(Plasmid #138176)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138176 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 42230)
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgActin
  • gRNA/shRNA sequence
    CCACCCCCACTCCTAAGAGG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Actb (a.k.a. Actx, E430023M04Rik, beta-actin)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer U6-F
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    H513 px330.sgActin.UTR.2 was a gift from Wen Xue (Addgene plasmid # 138176 ; http://n2t.net/addgene:138176 ; RRID:Addgene_138176)
  • For your References section:

    CRISPR-SONIC: targeted somatic oncogene knock-in enables rapid in vivo cancer modeling. Mou H, Ozata DM, Smith JL, Sheel A, Kwan SY, Hough S, Kucukural A, Kennedy Z, Cao Y, Xue W. Genome Med. 2019 Apr 16;11(1):21. doi: 10.1186/s13073-019-0627-9. 10.1186/s13073-019-0627-9 PubMed 30987660