Skip to main content

CDKN1A sgRNA
(Plasmid #138189)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138189 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LentiCRISPRv2 hygro
  • Backbone manufacturer
    Brett Stringer (Addgene plasmid #98291)
  • Total vector size (bp) 15261
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CDKN1A
  • Alt name
    p21
  • gRNA/shRNA sequence
    CACCGTCACCGAGACACCACTGGA
  • Species
    H. sapiens (human)
  • GenBank ID
    NG_009364.1 NM_000389.5
  • Entrez Gene
    CDKN1A (a.k.a. CAP20, CDKN1, CIP1, MDA-6, P21, SDI1, WAF1, p21CIP1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmB1 (destroyed during cloning)
  • 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3')
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CDKN1A sgRNA was a gift from Wen Xue (Addgene plasmid # 138189 ; http://n2t.net/addgene:138189 ; RRID:Addgene_138189)
  • For your References section:

    Depletion of TRRAP induces p53-independent senescence in liver cancer by downregulating mitotic genes. Kwan SY, Sheel A, Song CQ, Zhang XO, Jiang T, Dang H, Cao Y, Ozata DM, Mou H, Yin H, Weng Z, Wang XW, Xue W. Hepatology. 2019 Jun 12. doi: 10.1002/hep.30807. 10.1002/hep.30807 PubMed 31188495