Skip to main content

pCW57-MCS1-P2A-MCS2-mDux
(Plasmid #138320)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138320 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCW57-MCS1-P2A-MCS2 (Neo)
  • Backbone manufacturer
    Broad Insitute
  • Backbone size w/o insert (bp) 7943
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Dux
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2088
  • Entrez Gene
    Dux (a.k.a. AW822073, Dux4, Duxbl, EG664783)
  • Promoter TRE
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer agctcgtttagtgaaccgtcagat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57-MCS1-P2A-MCS2-mDux was a gift from Yi Zhang (Addgene plasmid # 138320 ; http://n2t.net/addgene:138320 ; RRID:Addgene_138320)
  • For your References section:

    Myc and Dnmt1 impede the pluripotent to totipotent state transition in embryonic stem cells. Fu X, Wu X, Djekidel MN, Zhang Y. Nat Cell Biol. 2019 Jul;21(7):835-844. doi: 10.1038/s41556-019-0343-0. Epub 2019 Jun 17. 10.1038/s41556-019-0343-0 PubMed 31209294