-
Purposelenti sgRNA cloning backbone with MS2 loops and EF1a-MCP-KRAB
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138460 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneplenti
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMCP-KRAB-IRES-zsGreen1
-
Insert Size (bp)2014
- Promoter EF1A
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGGATCTTGGTTCATTCTCAAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti_sgRNA(MS2)_MCP-KRAB-IRES-zsGreen1 was a gift from Jian Xu (Addgene plasmid # 138460 ; http://n2t.net/addgene:138460 ; RRID:Addgene_138460) -
For your References section:
Interrogation of enhancer function by enhancer-targeting CRISPR epigenetic editing. Li K, Liu Y, Cao H, Zhang Y, Gu Z, Liu X, Yu A, Kaphle P, Dickerson KE, Ni M, Xu J. Nat Commun. 2020 Jan 24;11(1):485. doi: 10.1038/s41467-020-14362-5. 10.1038/s41467-020-14362-5 PubMed 31980609