Skip to main content

pLenti-Puro-sgSIK3-A
(Plasmid #138682)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138682 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLentiCRISPR v2
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgSIK3 mouse
  • gRNA/shRNA sequence
    GCGAGCGGCCATCGACCCGC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Sik3 (a.k.a. 5730525O22Rik, 9030204A07Rik, Qsk, SIK-3, mKIAA0999)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-Puro-sgSIK3-A was a gift from Reuben Shaw (Addgene plasmid # 138682 ; http://n2t.net/addgene:138682 ; RRID:Addgene_138682)
  • For your References section:

    The AMPK-Related Kinases SIK1 and SIK3 Mediate Key Tumor-Suppressive Effects of LKB1 in NSCLC. Hollstein PE, Eichner LJ, Brun SN, Kamireddy A, Svensson RU, Vera LI, Ross DS, Rymoff TJ, Hutchins A, Galvez HM, Williams AE, Shokhirev MN, Screaton RA, Berdeaux R, Shaw RJ. Cancer Discov. 2019 Nov;9(11):1606-1627. doi: 10.1158/2159-8290.CD-18-1261. Epub 2019 Jul 26. 10.1158/2159-8290.CD-18-1261 PubMed 31350328