Skip to main content

pCAG-HASAP1-ST
(Plasmid #138965)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138965 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG
  • Total vector size (bp) 7902
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HASAP1-ST
  • Insert Size (bp)
    1794
  • Promoter CAG
  • Tag / Fusion Protein
    • somatic localization tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggaattcactcctcaggtgc
  • 3′ sequencing primer gactcgagcggccgcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-HASAP1-ST was a gift from Eric Schreiter (Addgene plasmid # 138965 ; http://n2t.net/addgene:138965 ; RRID:Addgene_138965)
  • For your References section:

    The HaloTag as a general scaffold for far-red tunable chemigenetic indicators. Deo C, Abdelfattah AS, Bhargava HK, Berro AJ, Falco N, Farrants H, Moeyaert B, Chupanova M, Lavis LD, Schreiter ER. Nat Chem Biol. 2021 Jun;17(6):718-723. doi: 10.1038/s41589-021-00775-w. Epub 2021 Apr 1. 10.1038/s41589-021-00775-w PubMed 33795886