pEGFP - FLAG-APEX2- hs Lamin B1
(Plasmid #139442)

• Purpose: APEX2-Lamin B1 expression plasmid
• Depositing Lab: Yixian Zheng
• Depositing Organization: Carnegie Institution for Science
  Located in United States of America
• Publication: Tran et al bioRxiv 2020.02.05.935635
• Citations: 1 Article

Backbone

• Vector backbone: Alice Ting (Addgene plasmid # 66171
• Backbone size w/o insert (bp): 4026
• Total vector size (bp): 6582
• Modifications to backbone: This backbone comes from Addgene #66171
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: LMNB1
• Alt name: Lamin B1
• Species: H. sapiens (human)
• Insert Size (bp): 1761
• Entrez Gene: LMNB1 (a.k.a. ADLD, LMN, LMN2, LMNB, MCPH26)
• Promoter: CMV
• Tags / Fusion Proteins:
  • FLAG (N terminal on backbone)
  • APEX2
  • 3xGGGGS linker (between APEX2 and Lamin B1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GACCTCGGGCTCGGGCTCC
• 3′ sequencing primer: CCTCAGCCACTGGAAATGTT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The parent backbone is from Alice Ting (Addgene plasmid # 66171; Lam et al Nat Methods. 2014 Nov 24. doi: 10.1038/nmeth.3179). This backbone was digested with BamHI and XhoI. The human Lmnb1 cDNA was amplified with a 5' primer containing the XhoI site and a 3x GGGGS linker. The 3' primer contained the BamHI site.

Please visit https://www.biorxiv.org/content/10.1101/2020.02.05.935635v1 for bioRxiv preprint.

DNA (Catalog # 139442-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 139442-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.