Skip to main content

pNTI661 pRPR1(TetO)-sgRNA
(Plasmid #139475)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139475 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRS41n
  • Backbone size w/o insert (bp) 4898
  • Total vector size (bp) 5171
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    single guide RNA scaffold
  • Alt name
    sgRNA
  • Species
    Synthetic; S pyogenes
  • Insert Size (bp)
    82
  • Promoter pRPR1(TetO)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cagcaacgcggcctttttacggttcctggcc
  • 3′ sequencing primer CAGGAAAGACCGCGGcttaaagtcatacattgcacgacta
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNTI661 pRPR1(TetO)-sgRNA was a gift from Nicholas Ingolia (Addgene plasmid # 139475 ; http://n2t.net/addgene:139475 ; RRID:Addgene_139475)
  • For your References section:

    A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeast. McGlincy NJ, Meacham ZA, Reynaud KK, Muller R, Baum R, Ingolia NT. BMC Genomics. 2021 Mar 23;22(1):205. doi: 10.1186/s12864-021-07518-0. 10.1186/s12864-021-07518-0 PubMed 33757429