pFLPe-AntiDsRed
(Plasmid
#139676)
-
PurposeCassette for testing FLPe recombinase activity using a fluorescent reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 139676 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBlueScript
- Backbone size w/o insert (bp) 2500
- Total vector size (bp) 5498
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAntiDsRed FLPe
-
SpeciesSynthetic
-
Insert Size (bp)746
- Promoter Maize Ubiquitin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tttattgccaaatgtttgaacg
- 3′ sequencing primer GATGCTCACCCTGTTGTTTGGTGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFLPe-AntiDsRed was a gift from James Birchler (Addgene plasmid # 139676 ; http://n2t.net/addgene:139676 ; RRID:Addgene_139676) -
For your References section:
Site-specific recombinase genome engineering toolkit in maize. Cody JP, Graham ND, Zhao C, Swyers NC, Birchler JA. Plant Direct. 2020 Mar 9;4(3):e00209. doi: 10.1002/pld3.209. eCollection 2020 Mar. 10.1002/pld3.209 PubMed 32166212