Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLX_lenti_osTir1_9Myc_P2A_Bsd
(Plasmid #139746)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 139746 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rice E3 ligase Tir1 (osTir1)
  • Promoter EF1alpha

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer tgatccggtgcctagagaaggtg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX_lenti_osTir1_9Myc_P2A_Bsd was a gift from Robert Tjian (Addgene plasmid # 139746 ; http://n2t.net/addgene:139746 ; RRID:Addgene_139746)
  • For your References section:

    3D ATAC-PALM: super-resolution imaging of the accessible genome. Xie L, Dong P, Chen X, Hsieh TS, Banala S, De Marzio M, English BP, Qi Y, Jung SK, Kieffer-Kwon KR, Legant WR, Hansen AS, Schulmann A, Casellas R, Zhang B, Betzig E, Lavis LD, Chang HY, Tjian R, Liu Z. Nat Methods. 2020 Apr;17(4):430-436. doi: 10.1038/s41592-020-0775-2. Epub 2020 Mar 16. 10.1038/s41592-020-0775-2 PubMed 32203384