-
Purposelentiviral vector expressing rice E3 ligase Tir1 in mammalian cells with selection marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 139746 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiviral vector
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerice E3 ligase Tir1 (osTir1)
- Promoter EF1alpha
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer tgatccggtgcctagagaaggtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX_lenti_osTir1_9Myc_P2A_Bsd was a gift from Robert Tjian (Addgene plasmid # 139746 ; http://n2t.net/addgene:139746 ; RRID:Addgene_139746) -
For your References section:
3D ATAC-PALM: super-resolution imaging of the accessible genome. Xie L, Dong P, Chen X, Hsieh TS, Banala S, De Marzio M, English BP, Qi Y, Jung SK, Kieffer-Kwon KR, Legant WR, Hansen AS, Schulmann A, Casellas R, Zhang B, Betzig E, Lavis LD, Chang HY, Tjian R, Liu Z. Nat Methods. 2020 Apr;17(4):430-436. doi: 10.1038/s41592-020-0775-2. Epub 2020 Mar 16. 10.1038/s41592-020-0775-2 PubMed 32203384