Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAG/Luci
(Plasmid #139981)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 139981 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV2/9.cTnT.PI.EGFP.RBG
  • Backbone manufacturer
    Penn Vector Core
  • Backbone size w/o insert (bp) 4405
  • Total vector size (bp) 5863
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Luciferase
  • Species
    Firefly
  • Insert Size (bp)
    1653
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NOTI (not destroyed)
  • 5′ sequencing primer ATGGAAGACGCCAAAAACATAAAG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG/Luci was a gift from William Pu (Addgene plasmid # 139981 ; http://n2t.net/addgene:139981 ; RRID:Addgene_139981)
  • For your References section:

    AAV Gene Therapy Prevents and Reverses Heart Failure in A Murine Knockout Model of Barth Syndrome. Wang S, Li Y, Xu Y, Ma Q, Lin Z, Schlame M, Bezzerides VJ, Strathdee D, Pu WT. Circ Res. 2020 Mar 9. doi: 10.1161/CIRCRESAHA.119.315956. 10.1161/CIRCRESAHA.119.315956 PubMed 32146862