-
PurposeLentiviral backbone for cloning expressed barcodes in the 3'UTR of the EGFP mRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140025 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLV
- Backbone size w/o insert (bp) 7712
- Total vector size (bp) 8432
-
Modifications to backboneInverted cassette (EF1a promoter - unidirectional polyA)
-
Vector typeLentiviral
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP
-
Alt nameenhanced green fluorescent protein
-
SpeciesAequorea victoria
-
GenBank IDU55762.1
- Promoter EF1alpha
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer cattctcaagcctcagacagtggtt
- 3′ sequencing primer gaaggcacaggtcgacaccagt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLARRY-EGFP was a gift from Fernando Camargo (Addgene plasmid # 140025 ; http://n2t.net/addgene:140025 ; RRID:Addgene_140025) -
For your References section:
Lineage tracing on transcriptional landscapes links state to fate during differentiation. Weinreb C, Rodriguez-Fraticelli A, Camargo FD, Klein AM. Science. 2020 Jan 23. pii: science.aaw3381. doi: 10.1126/science.aaw3381. 10.1126/science.aaw3381 PubMed 31974159