Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #140025)


Item Catalog # Description Quantity Price (USD)
Plasmid 140025 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 7712
  • Total vector size (bp) 8432
  • Modifications to backbone
    Inverted cassette (EF1a promoter - unidirectional polyA)
  • Vector type
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    enhanced green fluorescent protein
  • Species
    Aequorea victoria
  • GenBank ID
  • Promoter EF1alpha

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer cattctcaagcctcagacagtggtt
  • 3′ sequencing primer gaaggcacaggtcgacaccagt
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLARRY-EGFP was a gift from Fernando Camargo (Addgene plasmid # 140025 ; ; RRID:Addgene_140025)
  • For your References section:

    Lineage tracing on transcriptional landscapes links state to fate during differentiation. Weinreb C, Rodriguez-Fraticelli A, Camargo FD, Klein AM. Science. 2020 Jan 23. pii: science.aaw3381. doi: 10.1126/science.aaw3381. 10.1126/science.aaw3381 PubMed 31974159