pSW071
(Plasmid
#140037)
-
PurposePCC 11901 fadD locus KO with a kanamycin resistance cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140037 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 5266
-
Modifications to backboneUp and downstream sequences for homologous recombination into the PCC 11901 fadD locus
-
Vector typeGene knockout in cyanobacteria
-
Selectable markersAmpicillin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKanamycin resistance gene
-
Alt nameKanR
-
SpeciesSynthetic; Escherichia coli
-
Insert Size (bp)810
- Promoter KanR
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agtaggattgtagccatgatttcgg
- 3′ sequencing primer taggcacttggtttccgtccat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGenScript (pUC57-kan vector backbone)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/684944v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSW071 was a gift from Peter Nixon (Addgene plasmid # 140037 ; http://n2t.net/addgene:140037 ; RRID:Addgene_140037) -
For your References section:
Newly discovered Synechococcus sp. PCC 11901 is a robust cyanobacterial strain for high biomass production. Wlodarczyk A, Selao TT, Norling B, Nixon PJ. Commun Biol. 2020 May 7;3(1):215. doi: 10.1038/s42003-020-0910-8. 10.1038/s42003-020-0910-8 PubMed 32382027