pCRI008-PgpdA-Cas12aScaffold-BsmbI-Cas12aScaffold-TrcpT
(Plasmid
#140201)
-
Purpose(Empty Backbone) Fungal vector for one-step cloning of LbCas12a crRNA arrays and expression. Pgpda and pyroA are BsmbI domesticated.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140201 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneNew backbone modified from pYFAC-pyroA
-
Backbone manufacturerDOI: 10.1039/C8SC02870B
- Backbone size (bp) 11339
-
Modifications to backboneThe parts of pYFAC for replication in Saccharomyces cerevisiae were eliminated to avoid BsmbI sites and pyroA marker terminator region was BsmbI domesticated.
-
Vector typeCRISPR, Synthetic Biology ; Cloning of crRNA and expression in Aspergillus nidulans and related filamentous fungi.
- Promoter PgpdA
-
Selectable markersAf pyroA
-
Tags
/ Fusion Proteins
- dLbCas12a crRNA scaffold (N terminal on insert)
- dLbCas12a crRNA scaffold (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GTCAGTCCAACATTTGTTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloning of crRNA arrays is done with BsmbI digestion of the vector and ligation of annealed oligonucleotides containing the crRNA sequences, making use of the two crRNA scaffolds in the vector to start and finish the array. Electroporation is recommended for higher efficiency in cloning.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRI008-PgpdA-Cas12aScaffold-BsmbI-Cas12aScaffold-TrcpT was a gift from Yit Heng Chooi (Addgene plasmid # 140201 ; http://n2t.net/addgene:140201 ; RRID:Addgene_140201) -
For your References section:
CRISPR-mediated activation of biosynthetic gene clusters for bioactive molecule discovery in filamentous fungi. Roux I, Woodcraft C, Hu J, Wolters R, Gilchrist CLM, Chooi YH. ACS Synth Biol. 2020 Jun 11. doi: 10.1021/acssynbio.0c00197. 10.1021/acssynbio.0c00197 PubMed 32526136