Skip to main content

pCRI011-pYFAC-pyroA-PgpdA-4xcrRNAarrayelcA-TtrpC
(Plasmid #140203)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140203 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    New backbone modified from pYFAC-pyroA
  • Backbone manufacturer
    DOI: 10.1039/C8SC02870B
  • Backbone size w/o insert (bp) 14581
  • Total vector size (bp) 15789
  • Vector type
    CRISPR, Synthetic Biology
  • Selectable markers
    URA3 ; Af pyroA

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    crRNA array elcA
  • gRNA/shRNA sequence
    ATTCCACTCATCATAGTACT, GATGGTGGTGCTAGCTTCTC , CTCAACACTGTACTGGCAAC, AACATCCTTGTGTGAATATT
  • Species
    Parastagonospora nodorum elcA spacers, Lachnospiraceae bacterium Cas12a crRNA scaffold
  • Promoter PgpdA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmbI (destroyed during cloning)
  • 3′ cloning site BsmbI (destroyed during cloning)
  • 5′ sequencing primer GTCAGTCCAACATTTGTTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

To be contransformed with pCRI009-pKW20088-PelcA-mCherry-TtrpC-NotI-PacI in strains expressing dLbCas12a-VPR or dLbCas12a(D156R). These proof-of-concept vectors are intended to work as a positive control and aid the implementation of the CRISPRa vector set, facilitating initial testing and troubleshooting. The proof of concept activation is easily observable in Aspergillus nidulans with fluorescence microscopy.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRI011-pYFAC-pyroA-PgpdA-4xcrRNAarrayelcA-TtrpC was a gift from Yit Heng Chooi (Addgene plasmid # 140203 ; http://n2t.net/addgene:140203 ; RRID:Addgene_140203)
  • For your References section:

    CRISPR-mediated activation of biosynthetic gene clusters for bioactive molecule discovery in filamentous fungi. Roux I, Woodcraft C, Hu J, Wolters R, Gilchrist CLM, Chooi YH. ACS Synth Biol. 2020 Jun 11. doi: 10.1021/acssynbio.0c00197. 10.1021/acssynbio.0c00197 PubMed 32526136