pCRI011-pYFAC-pyroA-PgpdA-4xcrRNAarrayelcA-TtrpC
(Plasmid
#140203)
-
PurposeFungal vector to express an LbCas12a crRNA array targeted to Pelca, to be contransformed with pCRI009 containing PelcA-mCherry in a dLbCas12a-VPR strain as proof-of-concept of CRISPRa.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140203 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneNew backbone modified from pYFAC-pyroA
-
Backbone manufacturerDOI: 10.1039/C8SC02870B
- Backbone size w/o insert (bp) 14581
- Total vector size (bp) 15789
-
Vector typeCRISPR, Synthetic Biology
-
Selectable markersURA3 ; Af pyroA
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namecrRNA array elcA
-
gRNA/shRNA sequenceATTCCACTCATCATAGTACT, GATGGTGGTGCTAGCTTCTC , CTCAACACTGTACTGGCAAC, AACATCCTTGTGTGAATATT
-
SpeciesParastagonospora nodorum elcA spacers, Lachnospiraceae bacterium Cas12a crRNA scaffold
- Promoter PgpdA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmbI (destroyed during cloning)
- 3′ cloning site BsmbI (destroyed during cloning)
- 5′ sequencing primer GTCAGTCCAACATTTGTTGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To be contransformed with pCRI009-pKW20088-PelcA-mCherry-TtrpC-NotI-PacI in strains expressing dLbCas12a-VPR or dLbCas12a(D156R). These proof-of-concept vectors are intended to work as a positive control and aid the implementation of the CRISPRa vector set, facilitating initial testing and troubleshooting. The proof of concept activation is easily observable in Aspergillus nidulans with fluorescence microscopy.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRI011-pYFAC-pyroA-PgpdA-4xcrRNAarrayelcA-TtrpC was a gift from Yit Heng Chooi (Addgene plasmid # 140203 ; http://n2t.net/addgene:140203 ; RRID:Addgene_140203) -
For your References section:
CRISPR-mediated activation of biosynthetic gene clusters for bioactive molecule discovery in filamentous fungi. Roux I, Woodcraft C, Hu J, Wolters R, Gilchrist CLM, Chooi YH. ACS Synth Biol. 2020 Jun 11. doi: 10.1021/acssynbio.0c00197. 10.1021/acssynbio.0c00197 PubMed 32526136