pSLQ8666 pHR-RRM2p-BFP-T2A-N term (1-406) dLbCpf1-EE12RR345L-EFS-Zeo-WPRE
(Plasmid
#140228)
-
PurposeRRM2p-driven expression of BFP and N terminal dCpf1 (Cas12a) 406-split half with leucine zipper. Constitutive EFS-driven zeocin resistance.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140228 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedLbCpf1 (Cas12a) N terminal half (406) with zipper
-
SpeciesSynthetic
- Promoter RRM2 endogenous promoter
-
Tag
/ Fusion Protein
- BFP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgggtttattacagggacagcagag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ8666 pHR-RRM2p-BFP-T2A-N term (1-406) dLbCpf1-EE12RR345L-EFS-Zeo-WPRE was a gift from Stanley Qi (Addgene plasmid # 140228 ; http://n2t.net/addgene:140228 ; RRID:Addgene_140228) -
For your References section:
Multiple Input Sensing and Signal Integration Using a Split Cas12a System. Kempton HR, Goudy LE, Love KS, Qi LS. Mol Cell. 2020 Jan 30. pii: S1097-2765(20)30037-X. doi: 10.1016/j.molcel.2020.01.016. 10.1016/j.molcel.2020.01.016 PubMed 32027839