Skip to main content

Lenti-eCas9-sgMIB1
(Plasmid #140239)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140239 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Lenti-eCas9
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting human MIB1
  • gRNA/shRNA sequence
    GTTGGCGCTCGGGTAGTGCG
  • Species
    Synthetic
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmbI (unknown if destroyed)
  • 3′ cloning site BsmbI (unknown if destroyed)
  • 5′ sequencing primer TCTTGGGTAGTTTGCAGTTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-eCas9-sgMIB1 was a gift from Urs Greber (Addgene plasmid # 140239 ; http://n2t.net/addgene:140239 ; RRID:Addgene_140239)
  • For your References section:

    The E3 Ubiquitin Ligase Mind Bomb 1 Controls Adenovirus Genome Release at the Nuclear Pore Complex. Bauer M, Flatt JW, Seiler D, Cardel B, Emmenlauer M, Boucke K, Suomalainen M, Hemmi S, Greber UF. Cell Rep. 2019 Dec 17;29(12):3785-3795.e8. doi: 10.1016/j.celrep.2019.11.064. 10.1016/j.celrep.2019.11.064 PubMed 31851912