Lenti-eCas9-sgMIB1
(Plasmid
#140239)
-
PurposeLentiviral vector expressing high-specificity eSpCas9(1.1) and a gRNA targeting human MIB1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140239 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLenti-eCas9
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting human MIB1
-
gRNA/shRNA sequenceGTTGGCGCTCGGGTAGTGCG
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmbI (unknown if destroyed)
- 3′ cloning site BsmbI (unknown if destroyed)
- 5′ sequencing primer TCTTGGGTAGTTTGCAGTTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-eCas9-sgMIB1 was a gift from Urs Greber (Addgene plasmid # 140239 ; http://n2t.net/addgene:140239 ; RRID:Addgene_140239) -
For your References section:
The E3 Ubiquitin Ligase Mind Bomb 1 Controls Adenovirus Genome Release at the Nuclear Pore Complex. Bauer M, Flatt JW, Seiler D, Cardel B, Emmenlauer M, Boucke K, Suomalainen M, Hemmi S, Greber UF. Cell Rep. 2019 Dec 17;29(12):3785-3795.e8. doi: 10.1016/j.celrep.2019.11.064. 10.1016/j.celrep.2019.11.064 PubMed 31851912